Sequence retrieval

Genome: Burkholderia pseudomallei NCTC 13179
Start position: 1084000
End position: 1084023
Length: 24

DNA sequence
>NC_022659, from 1084000 to 1084023 (24 bp); Burkholderia pseudomallei NCTC 13179 CGAGCGCGCGCGCGAGCCCGAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1083384-1087490	Sequence	BBK_896 - hypothetical protein (Protein is coded in complementary strand; from 1087490 to 1083384)