Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 9340130
End position: 9340153
Length: 24

DNA sequence
>NC_022657, from 9340130 to 9340153 (24 bp); Actinoplanes friuliensis DSM 7358 GCCGTTGCCGTTCCCGTTGCCGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9340008-9342698	Sequence	AFR_42860 - putative transglycosylase (Protein is coded in complementary strand; from 9342698 to 9340008)