Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 9289780
End position: 9289824
Length: 45

DNA sequence
>NC_022657, from 9289780 to 9289824 (45 bp); Actinoplanes friuliensis DSM 7358 TTCGGGCTCGGGGTCTTCTGGCTCGGGGTCTTCGGGCTCGGGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9289400-9290875	Sequence	AFR_42650 - hypothetical protein (Protein is coded in complementary strand; from 9290875 to 9289400)