Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 9113391
End position: 9113450
Length: 60

DNA sequence
>NC_022657, from 9113391 to 9113450 (60 bp); Actinoplanes friuliensis DSM 7358 GTCGGGGCCGGTGCGGTCCGGGCCGGCGCGGTCGGGGCAGGGGTGGTCGGCGCCGGTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9113004-9116552	Sequence	AFR_41810 - DNA polymerase III subunits gamma and tau (Protein is coded in complementary strand; from 9116552 to 9113004)