Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 9059218
End position: 9059253
Length: 36

DNA sequence
>NC_022657, from 9059218 to 9059253 (36 bp); Actinoplanes friuliensis DSM 7358 TCCGCTCGCCAGCCCGTTCGCCAGTCCCCTCGCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9059100-9060407	Sequence	AFR_41580 - peptidase S8/S53 subtilisin kexin sedolisin