Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 9020951
End position: 9021004
Length: 54

DNA sequence
>NC_022657, from 9020951 to 9021004 (54 bp); Actinoplanes friuliensis DSM 7358 GCGTAGTTGCCGTCAGTCGCATAGCTGCCGCCAGTCCCGTAATTGCCGCCAGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9020489-9021385	Sequence	AFR_41410 - hypothetical protein (Protein is coded in complementary strand; from 9021385 to 9020489)