Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 8970757
End position: 8970792
Length: 36

DNA sequence
>NC_022657, from 8970757 to 8970792 (36 bp); Actinoplanes friuliensis DSM 7358 CGCCCAGCACCGAGCCCAGCACCACGACCAGCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8970582-8972813	Sequence	AFR_41170 - hypothetical protein (Protein is coded in complementary strand; from 8972813 to 8970582)