Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 896829
End position: 896876
Length: 48

DNA sequence
>NC_022657, from 896829 to 896876 (48 bp); Actinoplanes friuliensis DSM 7358 TTCTTCTCCGCGTTCTTCGCCGCGTTCCTGTCCGCGTTCTTGTCAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 896169-896891	Sequence	AFR_04030 - putative cation transporter (Protein is coded in complementary strand; from 896891 to 896169)