Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 8793860
End position: 8793919
Length: 60

DNA sequence
>NC_022657, from 8793860 to 8793919 (60 bp); Actinoplanes friuliensis DSM 7358 GGTCGTCGGAGGCGTGGTCGTCGGAGGCGTGGTCGTCGGAGGCGTGGTCGTCGGAGGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8792895-8794541	Sequence	AFR_40330 - hypothetical protein (Protein is coded in complementary strand; from 8794541 to 8792895)