Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 8769458
End position: 8769517
Length: 60

DNA sequence
>NC_022657, from 8769458 to 8769517 (60 bp); Actinoplanes friuliensis DSM 7358 CGTCCTGCGAGGCGTCCTTCGACGCATCCTGCGAGGCGTCCGGCGACGCGTCCTGCGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8769439-8770524	Sequence	AFR_40220 - putative NAD-dependent epimerase/dehydratase (Protein is coded in complementary strand; from 8770524 to 8769439)