Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 872729
End position: 872773
Length: 45

DNA sequence
>NC_022657, from 872729 to 872773 (45 bp); Actinoplanes friuliensis DSM 7358 GTGCCGCCCGGGAAACCGCCGCCGGGGAAAGCGCCGCCTGGGAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 872258-874363	Sequence	AFR_03925 - glycosyl transferase (Protein is coded in complementary strand; from 874363 to 872258)