Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 8673284
End position: 8673307
Length: 24

DNA sequence
>NC_022657, from 8673284 to 8673307 (24 bp); Actinoplanes friuliensis DSM 7358 CTCGAGGTCGAGGTCGAGCTCGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8671638-8678696	Sequence	AFR_39765 - modular polyketide synthase (Protein is coded in complementary strand; from 8678696 to 8671638)