Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 8668690
End position: 8668752
Length: 63

DNA sequence
>NC_022657, from 8668690 to 8668752 (63 bp); Actinoplanes friuliensis DSM 7358 GCCGGAACCGCCGGGCGCTGGCCCGGATTCGCCGGCCGCTGGGCCGGAGGTGCCGGCCGCTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8666623-8671632	Sequence	AFR_39760 - beta-ketoacyl synthase (Protein is coded in complementary strand; from 8671632 to 8666623)