Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 8642265
End position: 8642289
Length: 25

DNA sequence
>NC_022657, from 8642265 to 8642289 (25 bp); Actinoplanes friuliensis DSM 7358 CAGGTCGGGTGAGGTCAGGACCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8641489-8642400	Sequence	AFR_39655 - glycoside hydrolase family protein (Protein is coded in complementary strand; from 8642400 to 8641489)