Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 8620140
End position: 8620166
Length: 27

DNA sequence
>NC_022657, from 8620140 to 8620166 (27 bp); Actinoplanes friuliensis DSM 7358 ACCGTTCGAGCCGTTCGATCCGTTCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8618791-8622465	Sequence	AFR_39545 - putative sensor-like histidine kinase (Protein is coded in complementary strand; from 8622465 to 8618791)