Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 86089
End position: 86112
Length: 24

DNA sequence
>NC_022657, from 86089 to 86112 (24 bp); Actinoplanes friuliensis DSM 7358 TGCCGAGGCCGAAGCCGATGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 85965-86675	Sequence	AFR_00390 - hypothetical protein (Protein is coded in complementary strand; from 86675 to 85965)