Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 8571431
End position: 8571475
Length: 45

DNA sequence
>NC_022657, from 8571431 to 8571475 (45 bp); Actinoplanes friuliensis DSM 7358 TTCCGGGGTCGCTGCTTCCGAGGCTGCTGCTTCCGAGGCTGCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8569881-8573297	Sequence	AFR_39345 - Serine/threonine protein kinase (Protein is coded in complementary strand; from 8573297 to 8569881)