Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 8508017
End position: 8508061
Length: 45

DNA sequence
>NC_022657, from 8508017 to 8508061 (45 bp); Actinoplanes friuliensis DSM 7358 CTGGGGCTTGTCCTGCTTGGCCTTGTCCTGCTCGGCCCTGTCCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8507985-8508914	Sequence	AFR_39040 - hypothetical protein (Protein is coded in complementary strand; from 8508914 to 8507985)