Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 8444859
End position: 8444882
Length: 24

DNA sequence
>NC_022657, from 8444859 to 8444882 (24 bp); Actinoplanes friuliensis DSM 7358 CCGCCGCCACCGCCACCGCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8444070-8445611	Sequence	AFR_38730 - hypothetical protein (Protein is coded in complementary strand; from 8445611 to 8444070)