Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 8434650
End position: 8434676
Length: 27

DNA sequence
>NC_022657, from 8434650 to 8434676 (27 bp); Actinoplanes friuliensis DSM 7358 CCGGTCTCTCCGGTCTCTCCGGTCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8434065-8434736	Sequence	AFR_38680 - family 2 glycosyl transferase (Protein is coded in complementary strand; from 8434736 to 8434065)