Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 8349072
End position: 8349116
Length: 45

DNA sequence
>NC_022657, from 8349072 to 8349116 (45 bp); Actinoplanes friuliensis DSM 7358 CGCGCCGCGCAGGTCGGCTCCCCGCAGGTCGGCGCCGCGCAGATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8349013-8349771	Sequence	AFR_38275 - pentapeptide repeat-containing protein (Protein is coded in complementary strand; from 8349771 to 8349013)