Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 8268203
End position: 8268262
Length: 60

DNA sequence
>NC_022657, from 8268203 to 8268262 (60 bp); Actinoplanes friuliensis DSM 7358 GTCGGCGGCGGAGTCGTGGGAGGCGGGGTCGTCGGCGGCGGGGTCGTGGGCGGCGGCGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8267153-8268547	Sequence	AFR_37910 - putative glycosyl hydrolase (Protein is coded in complementary strand; from 8268547 to 8267153)