Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 822843
End position: 822866
Length: 24

DNA sequence
>NC_022657, from 822843 to 822866 (24 bp); Actinoplanes friuliensis DSM 7358 GCCGGTGACGGTGGCGGTGCCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 821848-824742	Sequence	AFR_03700 - hypothetical protein (Protein is coded in complementary strand; from 824742 to 821848)