Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 8082748
End position: 8082771
Length: 24

DNA sequence
>NC_022657, from 8082748 to 8082771 (24 bp); Actinoplanes friuliensis DSM 7358 CGACCGCGACGGCGAACGCGACCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8082336-8083511	Sequence	AFR_37020 - putative aminotransferase (Protein is coded in complementary strand; from 8083511 to 8082336)