Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 8059416
End position: 8059439
Length: 24

DNA sequence
>NC_022657, from 8059416 to 8059439 (24 bp); Actinoplanes friuliensis DSM 7358 CCGGCGCCAGCGCCCGCGCCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8059248-8060267	Sequence	AFR_36930 - putative LacI-family transcriptional regulator