Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 805894
End position: 805929
Length: 36

DNA sequence
>NC_022657, from 805894 to 805929 (36 bp); Actinoplanes friuliensis DSM 7358 ACCGCCACCCCGACCGCCACGCCGACTGCCACCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 805274-806128	Sequence	AFR_03670 - cell wall anchor domain-containing protein