Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 805891
End position: 805938
Length: 48

DNA sequence
>NC_022657, from 805891 to 805938 (48 bp); Actinoplanes friuliensis DSM 7358 CCTACCGCCACCCCGACCGCCACGCCGACTGCCACCCCGACCGCCACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 805274-806128	Sequence	AFR_03670 - cell wall anchor domain-containing protein