Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 7916316
End position: 7916351
Length: 36

DNA sequence
>NC_022657, from 7916316 to 7916351 (36 bp); Actinoplanes friuliensis DSM 7358 CGCGGCGGGCGCGGCGGCGGGCTCAGCGGCGGGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7916212-7917159	Sequence	AFR_36220 rpsB 30S ribosomal protein S2 (Protein is coded in complementary strand; from 7917159 to 7916212)