Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 7910952
End position: 7911005
Length: 54

DNA sequence
>NC_022657, from 7910952 to 7911005 (54 bp); Actinoplanes friuliensis DSM 7358 GCGAACTGCTCCTCGCGGGCGTACTGGTCCTCGCGGCCGAACTGGTCCTCACGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7910343-7911407	Sequence	AFR_36190 - Protein piccolo (Protein is coded in complementary strand; from 7911407 to 7910343)