Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 7855668
End position: 7855692
Length: 25

DNA sequence
>NC_022657, from 7855668 to 7855692 (25 bp); Actinoplanes friuliensis DSM 7358 GCGGGTCGGGGCGGAGCTGGGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7855022-7856341	Sequence	AFR_35950 - Multidrug resistance protein mdtK (Protein is coded in complementary strand; from 7856341 to 7855022)