Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 7799718
End position: 7799741
Length: 24

DNA sequence
>NC_022657, from 7799718 to 7799741 (24 bp); Actinoplanes friuliensis DSM 7358 GGGCCGGGGCCCGAGCCGGTGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7798845-7800365	Sequence	AFR_35720 - putative M28-family peptidase (Protein is coded in complementary strand; from 7800365 to 7798845)