Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 7767163
End position: 7767186
Length: 24

DNA sequence
>NC_022657, from 7767163 to 7767186 (24 bp); Actinoplanes friuliensis DSM 7358 CCGACGCTGACGCCGATGCGGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7767046-7768467	Sequence	AFR_35590 - response regulator receiver modulated diguanylate cyclase/phosphodiesterase with PAS/PAC sensor(s) (Protein is coded in complementary strand; from 7768467 to 7767046)