Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 7754304
End position: 7754366
Length: 63

DNA sequence
>NC_022657, from 7754304 to 7754366 (63 bp); Actinoplanes friuliensis DSM 7358 TGACCCGGCCGCCCAGCAGGCTGGCCCGGGCGCGCAGCGGGCTGGCCCGGACGACCGGCAGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7753638-7755752	Sequence	AFR_35530 - hypothetical protein (Protein is coded in complementary strand; from 7755752 to 7753638)