Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 752452
End position: 752475
Length: 24

DNA sequence
>NC_022657, from 752452 to 752475 (24 bp); Actinoplanes friuliensis DSM 7358 GGCCGCGGCCGGGTCCGCGGTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 751823-753022	Sequence	AFR_03395 - cytochrome P450 (Protein is coded in complementary strand; from 753022 to 751823)