Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 7449869
End position: 7449896
Length: 28

DNA sequence
>NC_022657, from 7449869 to 7449896 (28 bp); Actinoplanes friuliensis DSM 7358 GGGGCGCCGGGCGCGTGGCGCAGGGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7449527-7450939	Sequence	AFR_34120 - putative two component sensor kinase