Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 7387458
End position: 7387481
Length: 24

DNA sequence
>NC_022657, from 7387458 to 7387481 (24 bp); Actinoplanes friuliensis DSM 7358 CGACGAGGACGACGCCGACGGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7387409-7388404	Sequence	AFR_33870 - monosaccharide-transporting ATPase (Protein is coded in complementary strand; from 7388404 to 7387409)