Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 7325190
End position: 7325213
Length: 24

DNA sequence
>NC_022657, from 7325190 to 7325213 (24 bp); Actinoplanes friuliensis DSM 7358 GGCCGAGGTCGAGGTCGAGGTCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7324894-7325766	Sequence	AFR_33590 - hypothetical protein (Protein is coded in complementary strand; from 7325766 to 7324894)