Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 7321997
End position: 7322020
Length: 24

DNA sequence
>NC_022657, from 7321997 to 7322020 (24 bp); Actinoplanes friuliensis DSM 7358 GTCCGCGACCGCTTCCGCGTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7321128-7322225	Sequence	AFR_33570 - epoxide hydrolase domain-containing protein