Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 7263979
End position: 7264002
Length: 24

DNA sequence
>NC_022657, from 7263979 to 7264002 (24 bp); Actinoplanes friuliensis DSM 7358 AGCCCGAACCCGAGCGCGAGCACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7263349-7266993	Sequence	AFR_33310 - alpha-L-rhamnosidase (Protein is coded in complementary strand; from 7266993 to 7263349)