Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 7228598
End position: 7228621
Length: 24

DNA sequence
>NC_022657, from 7228598 to 7228621 (24 bp); Actinoplanes friuliensis DSM 7358 GCGTCGGCGGCGGTGTCGGCGTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7227590-7230271	Sequence	AFR_33180 - pyruvate phosphate dikinase (Protein is coded in complementary strand; from 7230271 to 7227590)