Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 7206307
End position: 7206330
Length: 24

DNA sequence
>NC_022657, from 7206307 to 7206330 (24 bp); Actinoplanes friuliensis DSM 7358 GGTCGCGGTGGCGGTCTCGTTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7206161-7206628	Sequence	AFR_33105 - putative methyl-accepting chemotaxis protein (Protein is coded in complementary strand; from 7206628 to 7206161)