Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 7056630
End position: 7056653
Length: 24

DNA sequence
>NC_022657, from 7056630 to 7056653 (24 bp); Actinoplanes friuliensis DSM 7358 AGCCGGAGCCGGAGCCGGAGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7056211-7057170	Sequence	AFR_32465 - hypothetical protein (Protein is coded in complementary strand; from 7057170 to 7056211)