Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 7055531
End position: 7055557
Length: 27

DNA sequence
>NC_022657, from 7055531 to 7055557 (27 bp); Actinoplanes friuliensis DSM 7358 CAGCGCGGGCCGCGCGGGCCGCGCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7055400-7055711	Sequence	AFR_32455 - hypothetical protein (Protein is coded in complementary strand; from 7055711 to 7055400)