Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 687522
End position: 687548
Length: 27

DNA sequence
>NC_022657, from 687522 to 687548 (27 bp); Actinoplanes friuliensis DSM 7358 CGTCCTTCTCGTCCTTCTCTTCCTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 687515-688030	Sequence	AFR_03115 - hypothetical protein (Protein is coded in complementary strand; from 688030 to 687515)