Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 6656759
End position: 6656812
Length: 54

DNA sequence
>NC_022657, from 6656759 to 6656812 (54 bp); Actinoplanes friuliensis DSM 7358 CACCCGGCCCGCCCGGCCCGCCCGGCCCGCCCGGCCCGCCCGGCCCGCCCGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 6655498-6656760	Sequence	AFR_30605 - adenosylmethionine-8-amino-7-oxononanoate aminotransferase (Protein is coded in complementary strand; from 6656760 to 6655498)