Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 6524646
End position: 6524669
Length: 24

DNA sequence
>NC_022657, from 6524646 to 6524669 (24 bp); Actinoplanes friuliensis DSM 7358 GGGCCTGGGGCTGAGCCTGGGGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6524417-6524776	Sequence	AFR_29950 - hypothetical protein (Protein is coded in complementary strand; from 6524776 to 6524417)