Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 6462492
End position: 6462515
Length: 24

DNA sequence
>NC_022657, from 6462492 to 6462515 (24 bp); Actinoplanes friuliensis DSM 7358 TCCGAATCCGAATCCGAATCCGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6461568-6463655	Sequence	AFR_29640 - putative chromosome segregation and condensation protein A (Protein is coded in complementary strand; from 6463655 to 6461568)