Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 6455090
End position: 6455113
Length: 24

DNA sequence
>NC_022657, from 6455090 to 6455113 (24 bp); Actinoplanes friuliensis DSM 7358 GCGCCGGCACCGGGGCCGTCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6452161-6456555	Sequence	AFR_29615 - serine/threonine protein kinase (Protein is coded in complementary strand; from 6456555 to 6452161)