Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 6220848
End position: 6220871
Length: 24

DNA sequence
>NC_022657, from 6220848 to 6220871 (24 bp); Actinoplanes friuliensis DSM 7358 TGGCGATGCCGATGGAGATGCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6219794-6220963	Sequence	AFR_28595 - ABC transporter permease (Protein is coded in complementary strand; from 6220963 to 6219794)