Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 6087571
End position: 6087594
Length: 24

DNA sequence
>NC_022657, from 6087571 to 6087594 (24 bp); Actinoplanes friuliensis DSM 7358 GCTGCGGCTGCGGCTGCGGCTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6087537-6088319	Sequence	AFR_27995 - hypothetical protein (Protein is coded in complementary strand; from 6088319 to 6087537)